Problem of The Day: Repeated DNA Sequences
Problem Statement
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
For example, "ACGAATTCCG" is a DNA sequence.
When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Example 1:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]
Example 2:
Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]
Constraints:
1 <= s.length <= 10^5
s[i] is either 'A', 'C', 'G', or 'T'.
Intuition
My initial thoughts on solving this problem involved using a sliding window approach to identify repeated DNA sequences within the given string.
Approach
I implemented a sliding window with a length of 10 characters, moving through the string and updating a hash map to keep track of the frequency of encountered substrings. Whenever a substring was of length 10, I added it to the hash map. At the end, I collected the substrings that appeared more than once.
Complexity
-
Time complexity: O(n), where n is the length of the input string s. This is because I iterate through the string once, and the operations within the loop take constant time.
-
Space complexity: O(m), where m is the number of distinct 10-character substrings in the input string. In the worst case, all substrings are distinct, leading to a hash map of size m.
Code
class Solution:
def findRepeatedDnaSequences(self, s: str) -> List[str]:
res = []
hash_map = defaultdict(int)
start = 0
for end in range(len(s)):
if end - start + 1 >= 10:
curr_str = s[start:end + 1]
hash_map[curr_str] += 1
start += 1
return [strg for strg, v in hash_map.items() if v > 1]
Editorial Solution
class Solution:
def findRepeatedDnaSequences(self, s: str) -> List[str]:
L, n = 10, len(s)
seen, output = set(), set()
# iterate over all sequences of length L
for start in range(n - L + 1):
tmp = s[start:start + L]
if tmp in seen:
output.add(tmp[:])
seen.add(tmp)
return output
Leave a comment